Review



ap2a2 crispr guide sgrna 2  (Broad Institute Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Broad Institute Inc ap2a2 crispr guide sgrna 2
    (A) Schematic diagrams of different baits (LLO truncations) constructs tested in the yeast 2-hybrid assay. (B) Quantification of secreted alpha-galactosidase activity following a GAL4-based two-hybrid interaction in Y2HGold yeast colonies. The results represented the percentage of alpha-galactosidase activity of positive control (p53+ SV40 large T antigen). Bars and error represent mean ± SD of replicate measurements. N=4 biological repeats *** p<0.001 (Student’s t-test). Results shown represent at least 3 independent experiments. (C) HEK 293T and HeLa cells were co-transfected with LLO-Myc tag and <t>Ap2a2-HA</t> tag plasmids. At 24 hours post transfection, cells were permeabilized and stained with anti-Myc (red), anti-HA antibodies (Green), and nuclear dye DAPI (blue). Scale bars are 10 μm. (B) Co-immunoprecipitation of Ap2a2 from transfected HEK293T cells using an anti-Myc-LLO antibody. Results shown represent 3 independent experiments. See also Figure S3.
    Ap2a2 Crispr Guide Sgrna 2, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ap2a2+crispr+guide+sgrna+2/ap2a2+crispr+guide+sgrna+2/pmc06007032-57-0-8
    Average 90 stars, based on 1 article reviews
    ap2a2 crispr guide sgrna 2 - by Bioz Stars, 2026-10
    90/100 stars

    Images

    1) Product Images from "The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection"

    Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection

    Journal: Cell host & microbe

    doi: 10.1016/j.chom.2018.05.006

    (A) Schematic diagrams of different baits (LLO truncations) constructs tested in the yeast 2-hybrid assay. (B) Quantification of secreted alpha-galactosidase activity following a GAL4-based two-hybrid interaction in Y2HGold yeast colonies. The results represented the percentage of alpha-galactosidase activity of positive control (p53+ SV40 large T antigen). Bars and error represent mean ± SD of replicate measurements. N=4 biological repeats *** p<0.001 (Student’s t-test). Results shown represent at least 3 independent experiments. (C) HEK 293T and HeLa cells were co-transfected with LLO-Myc tag and Ap2a2-HA tag plasmids. At 24 hours post transfection, cells were permeabilized and stained with anti-Myc (red), anti-HA antibodies (Green), and nuclear dye DAPI (blue). Scale bars are 10 μm. (B) Co-immunoprecipitation of Ap2a2 from transfected HEK293T cells using an anti-Myc-LLO antibody. Results shown represent 3 independent experiments. See also Figure S3.
    Figure Legend Snippet: (A) Schematic diagrams of different baits (LLO truncations) constructs tested in the yeast 2-hybrid assay. (B) Quantification of secreted alpha-galactosidase activity following a GAL4-based two-hybrid interaction in Y2HGold yeast colonies. The results represented the percentage of alpha-galactosidase activity of positive control (p53+ SV40 large T antigen). Bars and error represent mean ± SD of replicate measurements. N=4 biological repeats *** p<0.001 (Student’s t-test). Results shown represent at least 3 independent experiments. (C) HEK 293T and HeLa cells were co-transfected with LLO-Myc tag and Ap2a2-HA tag plasmids. At 24 hours post transfection, cells were permeabilized and stained with anti-Myc (red), anti-HA antibodies (Green), and nuclear dye DAPI (blue). Scale bars are 10 μm. (B) Co-immunoprecipitation of Ap2a2 from transfected HEK293T cells using an anti-Myc-LLO antibody. Results shown represent 3 independent experiments. See also Figure S3.

    Techniques Used: Construct, Y2H Assay, Activity Assay, Positive Control, Transfection, Staining, Immunoprecipitation

    (A) The intracellular growth of the wild type 10403S strain and the L. monocytogenes-LLO L461T strain in BMMs with the CRISPR/Cas9-mediated Ap2a2 knockout and sgRNA control BMMs. 50μg/ml gentamicin was added after 1h to kill extracellular bacteria. Results shown represent at least 3 independent experiments. (B) Schematic of hlyfl L. monocytogenes strain. The hly and tetL (tetracycline resistance) genes are flanked by loxP sites. Cre recombinase is expressed from the cytosol-specific actA promoter. Recombination between loxP sites leads to the excision of the DNA encoding hly and tetL. (C) Intracellular growth of the hlyfl L. monocytogenes strain in Ap2a2 knockout and control BMMs. 50μg/ml gentamicin was added to kill extracellular L. monocytogenes. Results are representative of at least 3 independent experiments. (D) Flow cytometry analysis of SYTOX Blue staining of control and Ap2a2 knockdown BMM infected for 8 hours with an effective MOI of 1. Positively stained cells resulted from the loss of plasma membrane integrity. No gentamicin was added for plasma membrane integrity assay. ** p<0.01, *** p<0.001 (Student’s t-test). Results shown represent 2 independent experiments. See also Figure S4.
    Figure Legend Snippet: (A) The intracellular growth of the wild type 10403S strain and the L. monocytogenes-LLO L461T strain in BMMs with the CRISPR/Cas9-mediated Ap2a2 knockout and sgRNA control BMMs. 50μg/ml gentamicin was added after 1h to kill extracellular bacteria. Results shown represent at least 3 independent experiments. (B) Schematic of hlyfl L. monocytogenes strain. The hly and tetL (tetracycline resistance) genes are flanked by loxP sites. Cre recombinase is expressed from the cytosol-specific actA promoter. Recombination between loxP sites leads to the excision of the DNA encoding hly and tetL. (C) Intracellular growth of the hlyfl L. monocytogenes strain in Ap2a2 knockout and control BMMs. 50μg/ml gentamicin was added to kill extracellular L. monocytogenes. Results are representative of at least 3 independent experiments. (D) Flow cytometry analysis of SYTOX Blue staining of control and Ap2a2 knockdown BMM infected for 8 hours with an effective MOI of 1. Positively stained cells resulted from the loss of plasma membrane integrity. No gentamicin was added for plasma membrane integrity assay. ** p<0.01, *** p<0.001 (Student’s t-test). Results shown represent 2 independent experiments. See also Figure S4.

    Techniques Used: CRISPR, Knock-Out, Control, Bacteria, Flow Cytometry, Staining, Knockdown, Infection, Clinical Proteomics, Membrane, Integrity Assay

    KEY RESOURCES TABLE
    Figure Legend Snippet: KEY RESOURCES TABLE

    Techniques Used: Virus, Recombinant, Staining, Flow Cytometry, Modification, Lysis, Transfection, Immunoprecipitation, Plasmid Preparation, CRISPR, Software, Microscopy

    Related Articles

    CRISPR:

    Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection
    Article Snippet: Ap2a2 CRISPR guide sgRNA 1 , AGGGCGAGACCCATAAACGT , Broad institute GPP Web Portal https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design. .. Ap2a2 CRISPR guide sgRNA 2 , TCACCTGACCTAGTTCCCAT , Broad institute GPP Web Portal https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design. .. Recombinant DNA , , .



    Similar Products

    ap2a2 crispr guide sgrna 2  (Broad Institute Inc)
    90
    Broad Institute Inc ap2a2 crispr guide sgrna 2
    (A) Schematic diagrams of different baits (LLO truncations) constructs tested in the yeast 2-hybrid assay. (B) Quantification of secreted alpha-galactosidase activity following a GAL4-based two-hybrid interaction in Y2HGold yeast colonies. The results represented the percentage of alpha-galactosidase activity of positive control (p53+ SV40 large T antigen). Bars and error represent mean ± SD of replicate measurements. N=4 biological repeats *** p<0.001 (Student’s t-test). Results shown represent at least 3 independent experiments. (C) HEK 293T and HeLa cells were co-transfected with LLO-Myc tag and <t>Ap2a2-HA</t> tag plasmids. At 24 hours post transfection, cells were permeabilized and stained with anti-Myc (red), anti-HA antibodies (Green), and nuclear dye DAPI (blue). Scale bars are 10 μm. (B) Co-immunoprecipitation of Ap2a2 from transfected HEK293T cells using an anti-Myc-LLO antibody. Results shown represent 3 independent experiments. See also Figure S3.
    Ap2a2 Crispr Guide Sgrna 2, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ap2a2+crispr+guide+sgrna+2/ap2a2+crispr+guide+sgrna+2/pmc06007032-57-0-8
    Average 90 stars, based on 1 article reviews
    ap2a2 crispr guide sgrna 2 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    (A) Schematic diagrams of different baits (LLO truncations) constructs tested in the yeast 2-hybrid assay. (B) Quantification of secreted alpha-galactosidase activity following a GAL4-based two-hybrid interaction in Y2HGold yeast colonies. The results represented the percentage of alpha-galactosidase activity of positive control (p53+ SV40 large T antigen). Bars and error represent mean ± SD of replicate measurements. N=4 biological repeats *** p<0.001 (Student’s t-test). Results shown represent at least 3 independent experiments. (C) HEK 293T and HeLa cells were co-transfected with LLO-Myc tag and Ap2a2-HA tag plasmids. At 24 hours post transfection, cells were permeabilized and stained with anti-Myc (red), anti-HA antibodies (Green), and nuclear dye DAPI (blue). Scale bars are 10 μm. (B) Co-immunoprecipitation of Ap2a2 from transfected HEK293T cells using an anti-Myc-LLO antibody. Results shown represent 3 independent experiments. See also Figure S3.

    Journal: Cell host & microbe

    Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection

    doi: 10.1016/j.chom.2018.05.006

    Figure Lengend Snippet: (A) Schematic diagrams of different baits (LLO truncations) constructs tested in the yeast 2-hybrid assay. (B) Quantification of secreted alpha-galactosidase activity following a GAL4-based two-hybrid interaction in Y2HGold yeast colonies. The results represented the percentage of alpha-galactosidase activity of positive control (p53+ SV40 large T antigen). Bars and error represent mean ± SD of replicate measurements. N=4 biological repeats *** p<0.001 (Student’s t-test). Results shown represent at least 3 independent experiments. (C) HEK 293T and HeLa cells were co-transfected with LLO-Myc tag and Ap2a2-HA tag plasmids. At 24 hours post transfection, cells were permeabilized and stained with anti-Myc (red), anti-HA antibodies (Green), and nuclear dye DAPI (blue). Scale bars are 10 μm. (B) Co-immunoprecipitation of Ap2a2 from transfected HEK293T cells using an anti-Myc-LLO antibody. Results shown represent 3 independent experiments. See also Figure S3.

    Article Snippet: Ap2a2 CRISPR guide sgRNA 2 , TCACCTGACCTAGTTCCCAT , Broad institute GPP Web Portal https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design.

    Techniques: Construct, Y2H Assay, Activity Assay, Positive Control, Transfection, Staining, Immunoprecipitation

    (A) The intracellular growth of the wild type 10403S strain and the L. monocytogenes-LLO L461T strain in BMMs with the CRISPR/Cas9-mediated Ap2a2 knockout and sgRNA control BMMs. 50μg/ml gentamicin was added after 1h to kill extracellular bacteria. Results shown represent at least 3 independent experiments. (B) Schematic of hlyfl L. monocytogenes strain. The hly and tetL (tetracycline resistance) genes are flanked by loxP sites. Cre recombinase is expressed from the cytosol-specific actA promoter. Recombination between loxP sites leads to the excision of the DNA encoding hly and tetL. (C) Intracellular growth of the hlyfl L. monocytogenes strain in Ap2a2 knockout and control BMMs. 50μg/ml gentamicin was added to kill extracellular L. monocytogenes. Results are representative of at least 3 independent experiments. (D) Flow cytometry analysis of SYTOX Blue staining of control and Ap2a2 knockdown BMM infected for 8 hours with an effective MOI of 1. Positively stained cells resulted from the loss of plasma membrane integrity. No gentamicin was added for plasma membrane integrity assay. ** p<0.01, *** p<0.001 (Student’s t-test). Results shown represent 2 independent experiments. See also Figure S4.

    Journal: Cell host & microbe

    Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection

    doi: 10.1016/j.chom.2018.05.006

    Figure Lengend Snippet: (A) The intracellular growth of the wild type 10403S strain and the L. monocytogenes-LLO L461T strain in BMMs with the CRISPR/Cas9-mediated Ap2a2 knockout and sgRNA control BMMs. 50μg/ml gentamicin was added after 1h to kill extracellular bacteria. Results shown represent at least 3 independent experiments. (B) Schematic of hlyfl L. monocytogenes strain. The hly and tetL (tetracycline resistance) genes are flanked by loxP sites. Cre recombinase is expressed from the cytosol-specific actA promoter. Recombination between loxP sites leads to the excision of the DNA encoding hly and tetL. (C) Intracellular growth of the hlyfl L. monocytogenes strain in Ap2a2 knockout and control BMMs. 50μg/ml gentamicin was added to kill extracellular L. monocytogenes. Results are representative of at least 3 independent experiments. (D) Flow cytometry analysis of SYTOX Blue staining of control and Ap2a2 knockdown BMM infected for 8 hours with an effective MOI of 1. Positively stained cells resulted from the loss of plasma membrane integrity. No gentamicin was added for plasma membrane integrity assay. ** p<0.01, *** p<0.001 (Student’s t-test). Results shown represent 2 independent experiments. See also Figure S4.

    Article Snippet: Ap2a2 CRISPR guide sgRNA 2 , TCACCTGACCTAGTTCCCAT , Broad institute GPP Web Portal https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design.

    Techniques: CRISPR, Knock-Out, Control, Bacteria, Flow Cytometry, Staining, Knockdown, Infection, Clinical Proteomics, Membrane, Integrity Assay

    KEY RESOURCES TABLE

    Journal: Cell host & microbe

    Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection

    doi: 10.1016/j.chom.2018.05.006

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: Ap2a2 CRISPR guide sgRNA 2 , TCACCTGACCTAGTTCCCAT , Broad institute GPP Web Portal https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design.

    Techniques: Virus, Recombinant, Staining, Flow Cytometry, Modification, Lysis, Transfection, Immunoprecipitation, Plasmid Preparation, CRISPR, Software, Microscopy